Showing
4 changed files
with
10 additions
and
15 deletions
EditMe
deleted
100644 → 0
1 | -# Please set the following variables to the correct paths : | ||
2 | -CPLEXDir="/opt/ibm/ILOG/CPLEX_Studio128" | ||
3 | -IEIGEN="/usr/local/include/eigen3" | ||
4 | -INUPACK="/usr/local/include/nupack" | ||
5 | -biorseoDir="/home/persalteas/Software/biorseo" | ||
6 | -jar3dexec="/home/persalteas/Software/jar3dbin/jar3d_2014-12-11.jar" | ||
7 | -bypdir="/home/persalteas/Software/BayesPairing/bayespairing/src" |
1 | -include EditMe | ||
2 | ICONCERT=/opt/ibm/ILOG/CPLEX_Studio_Community128/concert/include | 1 | ICONCERT=/opt/ibm/ILOG/CPLEX_Studio_Community128/concert/include |
3 | ICPLEX=/opt/ibm/ILOG/CPLEX_Studio_Community128/cplex/include | 2 | ICPLEX=/opt/ibm/ILOG/CPLEX_Studio_Community128/cplex/include |
4 | INUPACK=/usr/local/include/nupack | 3 | INUPACK=/usr/local/include/nupack | ... | ... |
... | @@ -14,10 +14,10 @@ COPY ./biorseo /biorseo | ... | @@ -14,10 +14,10 @@ COPY ./biorseo /biorseo |
14 | ADD http://rna.bgsu.edu/data/jar3d/models/jar3d_2014-12-11.jar / | 14 | ADD http://rna.bgsu.edu/data/jar3d/models/jar3d_2014-12-11.jar / |
15 | 15 | ||
16 | # install codes | 16 | # install codes |
17 | -RUN mkdir -p /biorseo/results && \ | 17 | +RUN cd /ViennaRNA && \ |
18 | - cd /ViennaRNA && \ | ||
19 | make install && \ | 18 | make install && \ |
20 | pip3 install --upgrade pip && \ | 19 | pip3 install --upgrade pip && \ |
21 | pip3 install networkx numpy regex wrapt biopython /BayesPairing && \ | 20 | pip3 install networkx numpy regex wrapt biopython /BayesPairing && \ |
21 | + cd / && \ | ||
22 | rm -rf /BayesPairing /ViennaRNA | 22 | rm -rf /BayesPairing /ViennaRNA |
23 | WORKDIR /biorseo | 23 | WORKDIR /biorseo |
... | \ No newline at end of file | ... | \ No newline at end of file | ... | ... |
... | @@ -44,7 +44,7 @@ cd ../.. | ... | @@ -44,7 +44,7 @@ cd ../.. |
44 | rm nupack3.2.2.tar.gz | 44 | rm nupack3.2.2.tar.gz |
45 | sudo cp nupack3.2.2/src/thermo/*.h /usr/local/include/nupack/thermo/ | 45 | sudo cp nupack3.2.2/src/thermo/*.h /usr/local/include/nupack/thermo/ |
46 | 46 | ||
47 | -# BayesPairing | 47 | +# BayesPairing: install on both the host (were we will train the models later) and the docker image (done by the Dockerfile) |
48 | sudo -H pip3 install --upgrade pip | 48 | sudo -H pip3 install --upgrade pip |
49 | sudo -H pip3 install networkx numpy regex wrapt biopython | 49 | sudo -H pip3 install networkx numpy regex wrapt biopython |
50 | git clone http://jwgitlab.cs.mcgill.ca/sarrazin/rnabayespairing.git BayesPairing | 50 | git clone http://jwgitlab.cs.mcgill.ca/sarrazin/rnabayespairing.git BayesPairing |
... | @@ -54,10 +54,12 @@ cd .. | ... | @@ -54,10 +54,12 @@ cd .. |
54 | 54 | ||
55 | 55 | ||
56 | ######################################################### Build Biorseo ########################################################### | 56 | ######################################################### Build Biorseo ########################################################### |
57 | +# build here, install later on the docker image (done by the Dockerfile) | ||
57 | git clone https://github.com/persalteas/biorseo.git | 58 | git clone https://github.com/persalteas/biorseo.git |
58 | cd biorseo | 59 | cd biorseo |
59 | mkdir -p results | 60 | mkdir -p results |
60 | make -j 4 | 61 | make -j 4 |
62 | +make clean | ||
61 | cd .. | 63 | cd .. |
62 | 64 | ||
63 | ######################################################## RNA modules ############################################################## | 65 | ######################################################## RNA modules ############################################################## |
... | @@ -81,16 +83,17 @@ mv IL modules/BGSU | ... | @@ -81,16 +83,17 @@ mv IL modules/BGSU |
81 | rm IL_3.2_models.zip | 83 | rm IL_3.2_models.zip |
82 | 84 | ||
83 | ######################################################## Build Docker container ################################################## | 85 | ######################################################## Build Docker container ################################################## |
86 | +# Execute the Dockerfile | ||
84 | docker build -t biorseo | 87 | docker build -t biorseo |
85 | -# docker run -v `pwd`/modules:/modules -v `pwd`/BayesPairing/bayespairing:/byp -v `pwd`/results:/biorseo/results biorseo ls /byp/models | ||
86 | 88 | ||
87 | -# Train Bayes Pairing | 89 | +# Train Bayes Pairing (it has been installed on the image and the source has been deleted, we train the models now, and will remount it as volume at run time) |
88 | -cd bayespairing/src | 90 | +cd BayesPairing/bayespairing/src |
89 | python3 parse_sequences.py -d rna3dmotif -seq ACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAAAGCCAUCAU -ss ".................................................................((...............)xxxx(...................................................)xxx).............." | 91 | python3 parse_sequences.py -d rna3dmotif -seq ACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAAAGCCAUCAU -ss ".................................................................((...............)xxxx(...................................................)xxx).............." |
90 | python3 parse_sequences.py -d 3dmotifatlas -seq ACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAAAGCCAUCAU -ss ".................................................................((...............)xxxx(...................................................)xxx).............." | 92 | python3 parse_sequences.py -d 3dmotifatlas -seq ACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAAAGCCAUCAU -ss ".................................................................((...............)xxxx(...................................................)xxx).............." |
91 | cd ../../.. | 93 | cd ../../.. |
92 | 94 | ||
93 | - | 95 | +# run it |
96 | +# docker run -v `pwd`/modules:/modules -v `pwd`/BayesPairing/bayespairing:/byp -v `pwd`/results:/biorseo/results biorseo ls /byp/models | ||
94 | 97 | ||
95 | 98 | ||
96 | ########################################################### More stuff ########################################################### | 99 | ########################################################### More stuff ########################################################### | ... | ... |
-
Please register or login to post a comment