Louis BECQUEY / biorseo

Go to a project
Toggle navigation Toggle navigation pinning
Louis BECQUEY
866a0c68 1 parent f5191702

Nettoyage + command line tests

Inline Side-by-side
Showing 8 changed files with 155 additions and 61 deletions
......@@ -6,8 +6,6 @@ from math import sqrt, ceil
import numpy as np
import matplotlib.pyplot as plt
log_path = "test.log"
log = open(log_path, 'a')
......@@ -112,7 +110,7 @@ def get_list_str_by_seq(name, estimator, function, list_str, true_str, modules):
max_mcc = get_mcc_structs_max(path_benchmark, name, estimator, function, extension, modules, true_str)
list_str.append(max_mcc)
# ================== Code from Louis Beckey Benchark.py ==============================
# ================== Code from Louis Becquey Benchark.py ==============================
def dbn_to_basepairs(structure):
parenthesis = []
brackets = []
......@@ -199,7 +197,7 @@ def f1_score(tp, tn, fp, fn):
def specificity(tp, tn, fp, fn):
return tn / (tn + fp)
# ================== Code from Louis Beckey Benchark.py ==============================
# ================== Code from Louis Becquey Benchark.py ==============================
#Get the best MCC value for all prediction of the results file of the sequence in argument
def get_mcc_structs_max(path_benchmark, sequence_id, estimator, function, extension, modules, true_structure):
......
......@@ -9,7 +9,7 @@ CC = g++
CFLAGS = -Icppsrc/ -I/usr/local/include -I$(CPLEX)/concert/include -I$(CPLEX)/cplex/include -g -O3
CXXFLAGS = --std=c++17 -Wall -Wpedantic -Wextra -Wno-deprecated-copy -Wno-ignored-attributes
LINKER = g++
LDFLAGS = -L$(CPLEX)/concert/lib/x86-64_linux/static_pic/ -L$(CPLEX)/cplex/lib/x86-64_linux/static_pic/ -lboost_system -lboost_filesystem -lboost_program_options -lgomp -lconcert -lilocplex -lcplex -lpthread -ldl -lRNA -lm
LDFLAGS = -Wno-free-nonheap-object -L$(CPLEX)/concert/lib/x86-64_linux/static_pic/ -L$(CPLEX)/cplex/lib/x86-64_linux/static_pic/ -lboost_system -lboost_filesystem -lboost_program_options -lgomp -lconcert -lilocplex -lcplex -lpthread -ldl -lRNA -lm
# change these to proper directories where each file should be
SRCDIR = cppsrc
......@@ -32,7 +32,7 @@ $(OBJECTS): $(OBJDIR)/%.o : $(SRCDIR)/%.cpp $(INCLUDES)
@echo -e "\033[00;32mCompiled "$<".\033[00m"
.PHONY: all
all: $(BINDIR)/$(TARGET) doc
all: $(BINDIR)/$(TARGET)
.PHONY: re
re: remove clean all
......
......@@ -87,11 +87,6 @@ MOIP::MOIP(const RNA& rna, string source, string source_path, float theta, bool
} else {
index_of_yuv_[u].push_back(rna_.get_RNA_length() * rna_.get_RNA_length() + 1);
}
/*for (u = 0; u < index_of_yuv_.size(); u++) {
for (v = 0; v < index_of_yuv_[u].size(); v++) {
cout << "["<< u << "]["<< v <<"]: " << index_of_yuv_[u][v] << endl;
}
}*/
if (verbose_) cout << endl;
// Add the x_i,j decision variables
......@@ -100,7 +95,7 @@ MOIP::MOIP(const RNA& rna, string source, string source_path, float theta, bool
index_of_xij_ = vector<vector<size_t>>(rna_.get_RNA_length() - 6, vector<size_t>(0));
for (u = 0; u < rna_.get_RNA_length() - 6; u++)
for (v = u + 4; v < rna_.get_RNA_length(); v++) // A basepair is possible if v > u+3
if (rna_.get_pij(u, v) > theta and rna_.get_pij(u + 1, v - 1) > theta) { // ou u-1 v+1 ??
if (rna_.get_pij(u, v) > theta and rna_.get_pij(u + 1, v - 1) > theta) { // or u-1 v+1 ??
if (verbose_) cout << u << '-' << v << " ";
index_of_xij_[u].push_back(c);
c++;
......@@ -110,11 +105,6 @@ MOIP::MOIP(const RNA& rna, string source, string source_path, float theta, bool
} else {
index_of_xij_[u].push_back(rna_.get_RNA_length() * rna_.get_RNA_length() + 1);
}
/*for (u = 0; u < index_of_xij_.size(); u++) {
for (v = 0; v < index_of_xij_[u].size(); v++) {
cout << "["<< u << "]["<< v <<"]: " << index_of_xij_[u][v] << endl;
}
}*/
if (verbose_) cout << endl;
// Look for insertions sites, then create the appropriate Cxip variables
......@@ -306,7 +296,7 @@ MOIP::MOIP(const RNA& rna, string source, string source_path, float theta, bool
}
else
{
cout << "!!! Unknown module source" << endl;
cout << "Err: Unknown module source." << endl;
}
// Add the Cx,i,p decision variables
......
/***
Biorseo, Louis Becquey, nov 2018-August 2020
Special thanks to Lénaic Durand for working a lot on version 2.0
louis.becquey@univ-evry.fr
Biorseo, Louis Becquey, nov 2018-nov 2021
Special thanks to Lénaic Durand and Nathalie Bertrand for working a lot on version 2.0
louis.becquey@univ-evry.fr (likely expired email account, find me on the internet)
***/
#include <cmath>
......@@ -60,8 +60,8 @@ int main(int argc, char* argv[])
string inputName, outputName, motifs_path_name, basename;
bool verbose = false;
float theta_p_threshold;
char obj_function_nbr = 'B';
char mea_or_mfe = 'b';
int obj_function_nbr, mychar;
char mea_or_mfe = 'b'; // a for MFE, b for MEA
list<Fasta> f;
ofstream outfile;
SecondaryStructure bestSSO1, bestSSO2;
......@@ -76,19 +76,19 @@ int main(int argc, char* argv[])
("seq,s", po::value<string>(&inputName)->required(), "Fasta file containing the RNA sequence")
("descfolder,d", po::value<string>(&motifs_path_name), "A folder containing modules in .desc format, as produced by Djelloul & Denise's catalog program")
("rinfolder,x", po::value<string>(&motifs_path_name), "A folder containing CaRNAval's RINs in .txt format, as produced by script transform_caRNAval_pickle.py")
("jsonfolder,a", po::value<string>(&motifs_path_name), "A folder containing the motif library of Isaure in .json format")
("jsonfolder,a", po::value<string>(&motifs_path_name), "A folder containing a custom motif library in .json format")
("jar3dcsv,j", po::value<string>(&motifs_path_name), "A file containing the output of JAR3D's search for motifs in the sequence, as produced by biorseo.py")
("bayespaircsv,b", po::value<string>(&motifs_path_name), "A file containing the output of BayesPairing's search for motifs in the sequence, as produced by biorseo.py")
("first-objective,c", po::value<unsigned int>(&MOIP::obj_to_solve_)->default_value(2), "Objective to solve in the mono-objective portions of the algorithm")
("output,o", po::value<string>(&outputName), "A file to summarize the computation results")
("theta,t", po::value<float>(&theta_p_threshold)->default_value(0.001), "Pairing probability threshold to consider or not the possibility of pairing")
("function,f", po::value<char>(&obj_function_nbr)->default_value('B'), "What objective function to use to include motifs: square of motif size in nucleotides like "
("theta,t", po::value<float>(&theta_p_threshold)->default_value(1e-3, "0.001"), "Pairing probability threshold to consider or not the possibility of pairing")
("function,f", po::value<int>(&obj_function_nbr)->default_value('B'), "What objective function to use to include motifs: square of motif size in nucleotides like "
"RNA-MoIP (A), light motif size + high number of components (B), site score (C), light motif size + site score + high number of components (D)")
("plop,p", po::value<int>(&mychar), "Just a test")
("MFE,e", "Use as function for objective 2 MFE (Minimum Free Energy)")
("MEA,a", "Use as function for objective 2 MEA (Maximum Expected Accuracy) it's also choose by default")
("mfe,E", "Minimize stacking energies as second criteria (should lead to MFE structure)")
("mea,A", "(default) Maximize expected accuracy as second criteria (should lead to MEA structure)")
("disable-pseudoknots,n", "Add constraints forbidding the formation of pseudoknots")
("limit,l", po::value<unsigned int>(&MOIP::max_sol_nbr_)->default_value(500), "Intermediate number of solutions in the Pareto set above which we give up the calculation.")
......@@ -104,34 +104,36 @@ int main(int argc, char* argv[])
cout << "Biorseo, bio-objective integer linear programming framework to predict RNA secondary "
"structures by including known RNA modules."
<< endl
<< "developped by Louis Becquey (louis.becquey@univ-evry.fr), 2018-2020" << endl
<< "developped by Louis Becquey, 2018-2021" << endl
<< "Lénaïc Durand, 2019" << endl
<< "Nathalie Bernard, 2021" << endl
<< endl
<< desc << endl;
return EXIT_SUCCESS;
}
if (vm.count("version")) {
cout << "Biorseo v2.0, dockerized, August 2020" << endl;
cout << "Biorseo v2.1, dockerized, November 2021" << endl;
return EXIT_SUCCESS;
}
if (vm.count("MFE")) mea_or_mfe = 'a';
if (vm.count("MEA")) {
mea_or_mfe = 'b';
}
if (vm.count("mfe")) mea_or_mfe = 'a';
if (vm.count("mea")) mea_or_mfe = 'b';
if (vm.count("verbose")) verbose = true;
if (vm.count("disable-pseudoknots")) MOIP::allow_pk_ = false;
if (!vm.count("jar3dcsv") and !vm.count("bayespaircsv") and !vm.count("descfolder") and !vm.count("rinfolder") and !vm.count("jsonfolder")) {
cerr << "\033[31mYou must provide at least one of --descfolder, --rinfolder, --jar3dcsv or --bayespaircsv.\033[0m See --help "
cerr << "\033[31mYou must provide at least one of --descfolder, --rinfolder, --jsonfolder, --jar3dcsv or --bayespaircsv.\033[0m See --help "
"for more information."
<< endl;
return EXIT_FAILURE;
}
if ((vm.count("-d") or vm.count("-x")) and (obj_function_nbr == 'C' or obj_function_nbr == 'D')) {
if ((vm.count("descfolder") or vm.count("jsonfolder") or vm.count("rinfolder")) and (obj_function_nbr == 'C' or obj_function_nbr == 'D')) {
cerr << "\033[31mYou must provide --jar3dcsv or --bayespaircsv to use --function C or --function D.\033[0m See "
"--help for more information."
<< endl;
return EXIT_FAILURE;
} else {
cout << "char: " << char(obj_function_nbr) << " defaulted: " << vm["function"].defaulted() << " plop: " << vm.count("plop") << " " << char(mychar) << endl;
}
po::notify(vm); // throws on error, so do after help in case there are any problems
......@@ -175,19 +177,17 @@ int main(int argc, char* argv[])
source = "rinfolder";
else if (vm.count("descfolder"))
source = "descfolder";
else
else if (vm.count("jsonfolder"))
source = "jsonfolder";
else
cerr << "ERR: no source of modules provided !" << endl;
return 0;
MOIP myMOIP = MOIP(myRNA, source, motifs_path_name.c_str(), theta_p_threshold, verbose);
double min, max;
IloConstraintArray F(myMOIP.get_env());
// return 0;
//test
/*string best_score;
bool flag = false;*/
if (verbose)
cout << "Solving..." << endl;
try {
......@@ -198,11 +198,6 @@ int main(int argc, char* argv[])
cout << endl << "Best solution according to objective 1 :" << bestSSO1.to_string() << endl;
cout << "Best solution according to objective 2 :" << bestSSO2.to_string() << endl;
}
//test
/*string s = bestSSO1.to_string();
string delimiter = "\t";
best_score = bestSSO1.to_string().substr(s.find(delimiter) + delimiter.size());
best_score = best_score.substr(0, best_score.find(delimiter));*/
// extend the Pareto set on top
if (MOIP::obj_to_solve_ == 1) {
......@@ -222,7 +217,6 @@ int main(int argc, char* argv[])
<< min << ": Obj" << 3 - MOIP::obj_to_solve_ << " being in [" << min << ", " << max << "]..." << endl;
myMOIP.search_between(min, max);
// extend the Pareto set below
if (MOIP::obj_to_solve_ == 1) {
if (verbose) cout << endl << "Solving obj1 below best solution 1." << endl;
......@@ -258,27 +252,27 @@ int main(int argc, char* argv[])
cout << "Best value for Motif insertion objective: " << bestSSO1.get_objective_score(1) << endl;
cout << "Best value for structure expected accuracy: " << bestSSO2.get_objective_score(2) << endl;
}
// Save it to file
if (vm.count("output")) {
if (verbose) cout << "Saving structures to " << outputName << "..." << endl;
outfile.open(outputName);
outfile << fa->name() << endl << fa->seq() << endl;
//cout << "----struc----" << endl << myMOIP.solution(0).to_string() << endl;
for (uint i = 0; i < myMOIP.get_n_solutions(); i++) {
outfile << myMOIP.solution(i).to_string() << endl << structure_with_contacts(myMOIP.solution(i)) << endl;
string str1 = myMOIP.solution(i).to_string();
//Check if the best score for obj2 is correctly include in the results
/*string delimiter = "\t";
string obj2 = str1.substr(str1.find(delimiter) + delimiter.size());
obj2 = obj2.substr(0, obj2.find(delimiter));
if (obj2.compare(best_score) == 0)
flag = true;*/
// Check if the best score for obj2 is actually included in the results
// string delimiter = "\t";
// string obj2 = str1.substr(str1.find(delimiter) + delimiter.size());
// obj2 = obj2.substr(0, obj2.find(delimiter));
// if (obj2.compare(best_score) == 0)
// flag = true;*/
}
/*if (!flag)
cout << "\033[1m\033[31mBest score not find for " << outputName << " !\033[0m" << endl;
else
cout << "OK for "<< outputName << "!" << endl;*/
// if (!flag)
// cout << "\033[1m\033[31mBest score not found for " << outputName << " !\033[0m" << endl;
// else
// cout << "OK for "<< outputName << "!" << endl;
outfile.close();
}
......
No preview for this file type
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON432 + JSON615 32.0000000 19.2280288
................****.................................................****
(((((((((([..)))....(((.((((((....).))))).])))((((.(...).)))))))))))..... + JSON169 + JSON432 + JSON615 48.0000000 19.2123884
................****..........****...................................****
(((((((.(([.....))..(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON478 52.0000000 18.3718588
............****................**...................................****
((((((((((...)))....(([.((((((....).)))))...))((((.(...).))))))))))).]... + JSON169 + JSON615 + JSON763 57.0000000 18.3583187
................****..........****.......***...........................**
(((((((((([..)))....(((.((((((....).))))).])))(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON615 64.0000000 18.2180422
................****..........****...............****................****
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 80.0000000 17.8060915
........**.....................***................*...........*........**
(((((([((([..))).)..((..((((((....).))))).]{))((((.(...).))))]})))))..... + JSON169 + JSON432 + JSON471 96.0000000 17.7717258
........**............*.......****......................*.....*......****
(((((.((((...)))....(((.(((((.[.....))))).){))((((.(..]).)))))})))))..... + JSON154 + JSON432 + JSON471 105.0000000 17.5888835
........**......**.............****.....................*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))((((.(...).)))))])))))..... + JSON169 + JSON432 + JSON471 + JSON615 112.0000000 17.5772109
........**......****..*.......****......................*.....*......****
(((((.((((...)))....(((.((((([[.....))))).){))(((.....]]..))))})))))..... + JSON154 + JSON386 + JSON432 + JSON471 121.0000000 16.5955778
........**......**.............****..............****...*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))(((.........))))])))))..... + JSON169 + JSON386 + JSON432 + JSON471 + JSON615 128.0000000 16.5828646
........**......****..*.......****...............****...*.....*......****
(((((.(.(([.........{)).(((((.(...).))))).][(}[[[[.[..)].]]]])])))))..... + JSON322 + JSON471 + JSON478 + JSON615 132.0000000 15.2549277
........**..********...........***................*...........*......****
(((((((.............(...((((((....).)))))....)(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON432 + JSON473 + JSON478 + JSON615 141.0000000 14.8831569
........************.**.......****.......****....****...............*****
((((((..(((.........))).(((((.......)))))....(((((.(...).)))))))))))..... + JSON38 2916.0000000 14.7452026
*******.*******......*****.....******............................********
((((((..(((.........))).(((((.......)))))....((((.........))))))))))..... + JSON38 + JSON386 2932.0000000 13.7508564
*******.*******......*****.....******............****............********
((((((..(((.........))).(((((.......)))))....((....(...)....))))))))..... + JSON38 + JSON473 2941.0000000 11.8254010
*******.*******......*****.....******..........****...*..........********
(((((((.............(...((((((....).)))))....)(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON432 + JSON473 + JSON478 + JSON615 141.0000000 14.8831569
........************.**.......****.......****....****..*.............****
(((((.(.(([.........{)).(((((.(...).))))).][(}[[[[.[..)].]]]])])))))..... + JSON322 + JSON471 + JSON478 + JSON615 132.0000000 15.2549277
........**..********...........***......................*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))((((.(...).)))))])))))..... + JSON169 + JSON432 + JSON471 + JSON615 112.0000000 17.5772109
........**......****..*.......****................*...........*......****
(((((.((((...)))....(((.(((((.[.....))))).){))((((.(..]).)))))})))))..... + JSON154 + JSON432 + JSON471 105.0000000 17.5888835
........**......**.............****...............*...........*......****
(((((([((([..))).)..((..((((((....).))))).]{))((((.(...).))))]})))))..... + JSON169 + JSON432 + JSON471 96.0000000 17.7717258
........**............*.......****................*...........*......****
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 80.0000000 17.8060915
........**.....................***......................*.....*........**
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON615 32.0000000 19.2280288
................****............**.....................................**
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON615 1.5000000 19.2280288
................****............**.....................................**
(((((((((([..)))....(((.(((((.(...).))))).])))((((.(...).)))))))))))..... + JSON322 + JSON615 1.5000200 19.2269926
................****............**.....................................**
(((((((.(([.....))..(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON478 1.7737056 18.3718588
............****................**...................................****
((((((((((...)))....(([.((((((....).)))))...))((((.(...).))))))))))).]... + JSON169 + JSON615 + JSON763 1.8613531 18.3583187
................****..........****.......***...........................**
.((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).))))))))))...... + JSON322 + JSON432 + JSON615 2.0000000 18.2455939
................****............**.................................******
(((((((((({..)))....(((.((((([([..).))))).})))(((....].]..))))))))))..... + JSON322 + JSON386 + JSON615 2.0000200 18.2347086
................****............**...............****..................**
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 3.0000000 17.8060915
........**.....................***......................*.....*........**
(((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))])))))..... + JSON322 + JSON471 + JSON615 3.5000000 17.6115766
........**......****...........***......................*.....*........**
.((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))]))))...... + JSON322 + JSON432 + JSON471 + JSON615 4.0000000 16.6291417
........**......****...........***......................*.....*....******
.((((.((((...)))....(((.((((([(...).))))).){))(((......]..))))}))))...... + JSON322 + JSON386 + JSON432 + JSON471 + JSON615 4.5000000 15.6358360
........**......****...........***...............****...*.....*....******
(((((.(.(([.........{)).(((((<(...).))))).][(}[[[.....)>..]]])])))))..... + JSON322 + JSON386 + JSON471 + JSON478 + JSON615 4.7737056 14.2616220
........**..********...........***...............****...*.....*......****
.((((.((((...)))....(((.(((((.(...).)))))[){))(....(...)...]))}))))...... + JSON322 + JSON432 + JSON471 + JSON473 + JSON615 4.8613531 13.7313706
........**......****...........***.............****...*.*.....*....******
.((((.((.....[[)....(]].((((([(...).)))))..{[)(((.....]]..))))}))))...... + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 5.0000000 13.7177100
........****.**.****...........***...............****...*.....*....******
(((((.(.((..........[)).(((((.(...).)))))(({(][....[..)]..))])})))))..... + JSON322 + JSON471 + JSON473 + JSON478 + JSON615 5.1350587 12.3759713
........**..********...........***.............****.....*.....*.....*****
.((((.....(..[[)....(]]..(((([(...).))))...{[)(((.....]]..))).}))))...... + JSON322 + JSON386 + JSON432 + JSON471 + JSON615 + JSON632 5.2737056 11.9911280
......****...**.****...**......***...............****...*.....*....******
.((((.((.....[[)....(]].(((((.(...).)))))[[{.)(....(...)..]]))}))))...... + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 5.3613531 11.8157013
........****.**.****...........***.............****...*.*.....*....******
.((....(.....[[)....(]].((((([(...).))))).{{[)(((.....]]..))).}.}))...... + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 + JSON928 5.5000000 11.2444565
...****.****.**.****...........***...............****...*.....*....******
.(........(..[[)....(]].((((([(...).))))).{{[)(((.....]]..))).}..})...... + JSON322 + JSON386 + JSON432 + JSON433 + JSON471 + JSON615 + JSON632 5.7737056 10.1268257
..********...**.****...........***...............****...*.....***..******
.((....(.....[[)....(]].(((((.(...).)))))[[{[)(....(..])..]]).}..))...... + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 + JSON928 5.8613531 9.3610813
...****.****.**.****...........***.............****.....*.....**...******
.((....(.....[[)....(]].((.[.[(...)....)).{{[)(((.....]].]))).}.}))...... + JSON156 + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 + JSON928 6.0000000 8.2749650
...****.****.**.****...........***.****..........****...*.....*....******
.(........(..[[)....(]].(((((.(...).)))))[[{.)(....(...)..]]).}...)...... + JSON322 + JSON432 + JSON433 + JSON471 + JSON473 + JSON615 + JSON632 6.1350587 8.2098083
..********...**.****...........***.............****...*.*.....***..******
.(........(..[[)....(]].((.[.[(...)....)).{{[)(((.....]].]))).}..})...... + JSON156 + JSON322 + JSON386 + JSON432 + JSON433 + JSON471 + JSON615 + JSON632 6.2737056 7.1573341
..********...**.****...........***.****..........****...*.....***..******
.((....(.....[[)....(]].((.[..(...)....)){{<[)(....(..]).]}}).>..))...... + JSON156 + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 + JSON928 6.3613531 6.3915897
...****.****.**.****...........***.****........****.....*.....**...******
.(........(..[[)....(]].((.[..(...)....)){{<.)(....(...).]}}).>...)...... + JSON156 + JSON322 + JSON432 + JSON433 + JSON471 + JSON473 + JSON615 + JSON632 6.6350587 5.2403168
..********...**.****...........***.****........****...*.*.....***..******
.((((.((((...)))....((..(((((.({..).)))))[[<))(....(.}.)..]]))>))))...... + JSON322 + JSON432 + JSON471 + JSON473 + JSON615 4.8613531 13.7314599
........**......****..*.........**.............****...*.*.....*....******
.((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))]))))...... + JSON322 + JSON432 + JSON471 + JSON615 4.0000000 16.6291417
........**......****...........***................*...........*....******
(((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))])))))..... + JSON322 + JSON471 + JSON615 3.5000000 17.6115766
........**......****...........***................*...........*........**
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 3.0000000 17.8060915
........**.....................***................*...........*........**
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... 0.0000000 19.2280288
.........................................................................
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 0.0000000 19.2280288
................................**.....................................**