Louis BECQUEY / biorseo

Go to a project
Toggle navigation Toggle navigation pinning
Louis BECQUEY
831e01d6 1 parent 14327b61

Removed support for BayesPairing & Jar3d

Expand all
Inline Side-by-side
Showing 9 changed files with 49 additions and 340 deletions
This diff is collapsed. Click to expand it.
This diff is collapsed. Click to expand it.
......@@ -1142,178 +1142,9 @@ void MOIP::allowed_motifs_from_rin(args_of_parallel_func arg_struct)
}
}
//Check if the sequence is a rna sequence (ATGC) and replace T by U or remove modified nucleotide if necessary
string check_motif_sequence(string seq) {
std::transform(seq.begin(), seq.end(), seq.begin(), ::toupper);
for (int i = seq.size(); i >= 0; i--) {
if(seq[i] == 'T') {
seq[i] = 'U';
} else if (!(seq [i] == 'A' || seq [i] == 'U' || seq [i] == '&'
|| seq [i] == 'G' || seq [i] == 'C')) {
seq = seq.erase(i,1);
}
}
return seq;
}
// Based on the 2d structure find all positions of the pairings.
vector<Link> search_pairing(string& struc, vector<Component>& v) {
vector<Link> vec;
stack<uint> parentheses;
stack<uint> crochets;
stack<uint> accolades;
stack<uint> chevrons;
uint count = 0;
uint debut = v[count].pos.first;
uint gap = 0;
for (uint i = 0; i < struc.size(); i++) {
if (struc[i] == '(') {
parentheses.push(i + debut + gap - count);
} else if (struc[i] == ')') {
Link l;
l.nts.first = parentheses.top();
l.nts.second = i + debut + gap - count;
vec.push_back(l);
parentheses.pop();
} else if (struc[i] == '[') {
crochets.push(i + debut + gap - count);
} else if (struc[i] == ']') {
Link l;
l.nts.first = crochets.top();
l.nts.second = i + debut + gap - count;
vec.push_back(l);
crochets.pop();
} else if (struc[i] == '{') {
accolades.push(i + debut + gap - count);
} else if (struc[i] == '}') {
Link l;
l.nts.first = accolades.top();
l.nts.second = i + debut + gap - count;
vec.push_back(l);
accolades.pop();
} else if (struc[i] == '<') {
chevrons.push(i + debut + gap - count);
} else if (struc[i] == '>') {
Link l;
l.nts.first = chevrons.top();
l.nts.second = i + debut + gap - count;
vec.push_back(l);
chevrons.pop();
} else if (struc[i] == '&') {
count ++;
gap += v[count].pos.first - v[count - 1].pos.second - 1;
}
}
return vec;
}
size_t count_contacts(string contacts) {
size_t count = 0;
for (uint i = 0; i < contacts.size(); i++) {
if (contacts[i] == '*') {
count++;
}
}
return count;
}
uint find_max_occurrences (string filepath) {
uint max = 0;
std::ifstream in = std::ifstream(filepath);
json js = json::parse(in);
string contacts_id;
for(auto it = js.begin(); it != js.end(); ++it) {
contacts_id = it.key();
for(auto it2 = js[contacts_id].begin(); it2 != js[contacts_id].end(); ++it2) {
string test = it2.key();
if (!test.compare("occurences")) {
uint occ = it2.value();
if (occ > max) {
max = occ;
}
}
}
}
return max;
}
uint find_max_sequence (string filepath) {
uint max = 0;
std::ifstream in = std::ifstream(filepath);
json js = json::parse(in);
string contacts_id;
string seq;
for(auto it = js.begin(); it != js.end(); ++it) {
contacts_id = it.key();
for(auto it2 = js[contacts_id].begin(); it2 != js[contacts_id].end(); ++it2) {
string test = it2.key();
if (!test.compare("sequence")) {
seq = it2.value();
uint size = seq.size();
if (size > max) {
max = size;
}
}
}
}
return max;
}
vector<string> find_components(string sequence, string delimiter) {
vector<string> list;
string seq = sequence;
string subseq;
uint fin = 0;
while(seq.find(delimiter) != string::npos) {
fin = seq.find(delimiter);
subseq = seq.substr(0, fin);
seq = seq.substr(fin + 1);
list.push_back(subseq); // new component sequence
}
if (!seq.empty()) {
list.push_back(seq);
}
return list;
}
vector<uint> find_contacts(vector<string>& struc2d, vector<Component>& v) {
vector<uint> positions;
string delimiter = "*";
uint debut;
for (uint i = 0; i < v.size(); i++) {
debut = v[i].pos.first;
uint pos = struc2d[i].find(delimiter, 0);
while(pos != string::npos && pos <= struc2d[i].size())
{
positions.push_back(pos + debut);
pos = struc2d[i].find(delimiter, pos+1);
}
}
return positions;
}
void MOIP::allowed_motifs_from_json(args_of_parallel_func arg_struct, vector<pair<uint, char>> errors_id)
{
/*
Searches where to place some JSON motifs in the RNA
*/
// Searches where to place some JSON motifs in the RNA
path jsonfile = arg_struct.motif_file;
mutex& posInsertionSites_access = arg_struct.posInsertionSites_mutex;
......@@ -1389,7 +1220,7 @@ void MOIP::allowed_motifs_from_json(args_of_parallel_func arg_struct, vector<pai
if (verbose_) cout << "\t> Considering motif JSON " << contacts_id << "\t" << seq << ", " << struct2d << " ";
Motif temp_motif = Motif(v, contacts_id, nb_contacts, tx_occurrences);
temp_motif.links_ = search_pairing(struct2d, v);
temp_motif.links_ = build_motif_pairs(struct2d, v);
temp_motif.pos_contacts = find_contacts(component_contacts, v);
// Check if the motif can be inserted, checking the basepairs probabilities and theta
......@@ -1421,4 +1252,4 @@ void MOIP::allowed_motifs_from_json(args_of_parallel_func arg_struct, vector<pai
component_sequences.clear();
}
}
}
\ No newline at end of file
......
This diff is collapsed. Click to expand it.
......@@ -86,6 +86,18 @@ vector<Motif> load_json_folder(const string& path, const string& r
vector<vector<Component>> find_next_ones_in(string rna, uint offset, vector<string>& vc);
vector<vector<Component>> json_find_next_ones_in(string rna, uint offset, vector<string>& vc);
// utilities for Json motifs
size_t count_nucleotide(string&);
size_t count_delimiter(string&);
size_t count_contacts(string&);
string check_motif_sequence(string);
bool checkSecondaryStructure(string);
vector<Link> build_motif_pairs(string&, vector<Component>&);
uint find_max_occurrences(string&);
uint find_max_sequence(string&);
vector<string> find_components(string&, string);
vector<uint> find_contacts(vector<string>&, vector<Component>&);
// utilities to compare secondary structures:
bool operator==(const Motif& m1, const Motif& m2);
bool operator!=(const Motif& m1, const Motif& m2);
......
......@@ -74,67 +74,57 @@ int main(int argc, char* argv[])
("help,h", "Print the help message")
("version", "Print the program version")
("seq,s", po::value<string>(&inputName)->required(), "Fasta file containing the RNA sequence")
("descfolder,d", po::value<string>(&motifs_path_name), "A folder containing modules in .desc format, as produced by Djelloul & Denise's catalog program")
("rinfolder,x", po::value<string>(&motifs_path_name), "A folder containing CaRNAval's RINs in .txt format, as produced by script transform_caRNAval_pickle.py")
("jsonfolder,a", po::value<string>(&motifs_path_name), "A folder containing a custom motif library in .json format")
("jar3dcsv,j", po::value<string>(&motifs_path_name), "A file containing the output of JAR3D's search for motifs in the sequence, as produced by biorseo.py")
("bayespaircsv,b", po::value<string>(&motifs_path_name), "A file containing the output of BayesPairing's search for motifs in the sequence, as produced by biorseo.py")
("first-objective,c", po::value<unsigned int>(&MOIP::obj_to_solve_)->default_value(2), "Objective to solve in the mono-objective portions of the algorithm")
("descfolder,d", po::value<string>(&motifs_path_name), "A folder containing modules in .desc format, as produced by Djelloul & Denise's catalog program (deprecated)")
("rinfolder,r", po::value<string>(&motifs_path_name), "A folder containing CaRNAval's RINs in .txt format, as produced by script transform_caRNAval_pickle.py")
("jsonfolder,j", po::value<string>(&motifs_path_name), "A folder containing a custom motif library in .json format")
("pre-placed,x", po::value<string>(&motifs_path_name), "A CSV file providing motif insertion sites obtained with another tool.")
("function,f", po::value<char>(&obj_function_nbr)->default_value('B'),
"(A, B, C, D, E or F) Objective function to score module insertions:\n"
" (A) insert big modules\n (B) light, high-order modules\n"
" (C) well-scored modules\n (D) light, high-order, well-scored\n modules\n"
" (E, F) insert big modules with many\n contacts with proteins, different\n ponderations.\n"
" C and D require position scores\n provided by --pre-placed.\n"
" E and F require protein-contact\n information and should be\n used only with --jsonfolder.")
("mfe,E", "Minimize stacking energies\n (leads to MFE extimator)")
("mea,A", "(default) Maximize expected accuracy\n (leads to MEA estimator)")
("first-objective,c", po::value<unsigned int>(&MOIP::obj_to_solve_)->default_value(2),
"(1 or 2) Objective to solve in the mono-objective portions of the algorithm.\n"
" (1) is the module objective,\n given by --function\n"
" (2) is energy-based objective,\n either MFE or MEA")
("output,o", po::value<string>(&outputName), "A file to summarize the computation results")
("theta,t", po::value<float>(&theta_p_threshold)->default_value(1e-3, "0.001"), "Pairing probability threshold to consider or not the possibility of pairing")
("function,f", po::value<char>(&obj_function_nbr)->default_value('B'), "What objective function to use to include motifs: square of motif size in nucleotides like "
"RNA-MoIP (A), light motif size + high number of components (B), site score (C), light motif size + site score + high number of components (D)")
("mfe,E", "Minimize stacking energies as second criteria (should lead to MFE structure)")
("mea,A", "(default) Maximize expected accuracy as second criteria (should lead to MEA structure)")
("disable-pseudoknots,n", "Add constraints forbidding the formation of pseudoknots")
("limit,l", po::value<unsigned int>(&MOIP::max_sol_nbr_)->default_value(500), "Intermediate number of solutions in the Pareto set above which we give up the calculation.")
("verbose,v", "Print what is happening to stdout");
("verbose,v", "Print what is happening to console");
po::variables_map vm;
po::store(po::parse_command_line(argc, argv, desc), vm);
basename = remove_ext(inputName.c_str(), '.', '/');
try {
po::store(po::parse_command_line(argc, argv, desc), vm); // can throw
po::notify(vm);
if (vm.count("help") or vm.count("-h")) {
cout << "Biorseo, bio-objective integer linear programming framework to predict RNA secondary "
"structures by including known RNA modules."
<< endl
<< "developped by Louis Becquey, 2018-2021" << endl
<< "Lénaïc Durand, 2019" << endl
<< "Nathalie Bernard, 2021" << endl
<< endl
<< desc << endl;
cout << "Biorseo, Bi-Objective RNA Structure Efficient Optimizer" << endl
<< "Bio-objective integer linear programming framework to predict RNA secondary structures by including known RNA modules." << endl
<< "Developped by Louis Becquey, 2018-2021\nLénaïc Durand, 2019\nNathalie Bernard, 2021" << endl << endl
<< "Usage:\tYou must provide:\n\t1) a FASTA input file with -s," << endl
<< "\t2) a module type with --rna3dmotifs, --carnaval, --contacts or --pre-placed," << endl
<< "\t3) one module-based scoring function with --func A, B, C, D, E or F," << endl
<< "\t4) one energy-based scoring function with --mfe or --mea," << endl
<< "\t5) how to display results: in console (-v), or in a result file (-o)." << endl
<< endl
<< desc << endl;
return EXIT_SUCCESS;
}
if (vm.count("version")) {
cout << "Biorseo v2.1, dockerized, November 2021" << endl;
return EXIT_SUCCESS;
}
po::notify(vm); // throws on error, so do after help in case there are any problems
if (vm.count("mfe")) mea_or_mfe = 'a';
if (vm.count("mea")) mea_or_mfe = 'b';
if (vm.count("verbose")) verbose = true;
if (vm.count("disable-pseudoknots")) MOIP::allow_pk_ = false;
if (!vm.count("jar3dcsv") and !vm.count("bayespaircsv") and !vm.count("descfolder") and !vm.count("rinfolder") and !vm.count("jsonfolder")) {
cerr << "\033[31mYou must provide at least one of --descfolder, --rinfolder, --jsonfolder, --jar3dcsv or --bayespaircsv.\033[0m See --help "
"for more information."
<< endl;
return EXIT_FAILURE;
}
if ((vm.count("descfolder") or vm.count("jsonfolder") or vm.count("rinfolder")) and (obj_function_nbr == 'C' or obj_function_nbr == 'D')) {
cerr << "\033[31mYou must provide --jar3dcsv or --bayespaircsv to use --function C or --function D.\033[0m See "
"--help for more information."
<< endl;
return EXIT_FAILURE;
}
po::notify(vm); // throws on error, so do after help in case there are any problems
} catch (po::error& e) {
cerr << "ERROR: \033[31m" << e.what() << "\033[0m" << endl;
cerr << desc << endl;
......@@ -158,7 +148,7 @@ int main(int argc, char* argv[])
myRNA = RNA(fa->name(), fa->seq(), verbose);
if (verbose) cout << "\t> " << inputName << " successfuly loaded (" << myRNA.get_RNA_length() << " nt)" << endl;
// load CSV file
// check motif folder exists
if (access(motifs_path_name.c_str(), F_OK) == -1) {
cerr << "\033[31m" << motifs_path_name << " not found\033[0m" << endl;
return EXIT_FAILURE;
......@@ -167,16 +157,14 @@ int main(int argc, char* argv[])
/* FIND PARETO SET */
string source;
if (vm.count("jar3dcsv"))
source = "jar3dcsv";
else if (vm.count("bayespaircsv"))
source = "bayespaircsv";
else if (vm.count("rinfolder"))
if (vm.count("rinfolder"))
source = "rinfolder";
else if (vm.count("descfolder"))
source = "descfolder";
else if (vm.count("jsonfolder"))
source = "jsonfolder";
else if (vm.count("pre-placed"))
source = "csvfile";
else
cerr << "ERR: no source of modules provided !" << endl;
......@@ -254,22 +242,12 @@ int main(int argc, char* argv[])
if (verbose) cout << "Saving structures to " << outputName << "..." << endl;
outfile.open(outputName);
outfile << fa->name() << endl << fa->seq() << endl;
for (uint i = 0; i < myMOIP.get_n_solutions(); i++) {
outfile << myMOIP.solution(i).to_string() << endl << structure_with_contacts(myMOIP.solution(i)) << endl;
string str1 = myMOIP.solution(i).to_string();
// Check if the best score for obj2 is actually included in the results
// string delimiter = "\t";
// string obj2 = str1.substr(str1.find(delimiter) + delimiter.size());
// obj2 = obj2.substr(0, obj2.find(delimiter));
// if (obj2.compare(best_score) == 0)
// flag = true;*/
}
// if (!flag)
// cout << "\033[1m\033[31mBest score not found for " << outputName << " !\033[0m" << endl;
// else
// cout << "OK for "<< outputName << "!" << endl;
outfile.close();
}
......
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON432 + JSON615 32.0000000 19.2280288
................****.................................................****
(((((((((([..)))....(((.((((((....).))))).])))((((.(...).)))))))))))..... + JSON169 + JSON432 + JSON615 48.0000000 19.2123884
................****..........****...................................****
(((((((.(([.....))..(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON478 52.0000000 18.3718588
............****................**...................................****
((((((((((...)))....(([.((((((....).)))))...))((((.(...).))))))))))).]... + JSON169 + JSON615 + JSON763 57.0000000 18.3583187
................****..........****.......***...........................**
(((((((((([..)))....(((.((((((....).))))).])))(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON615 64.0000000 18.2180422
................****..........****...............****................****
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 80.0000000 17.8060915
........**.....................***................*...........*........**
(((((([((([..))).)..((..((((((....).))))).]{))((((.(...).))))]})))))..... + JSON169 + JSON432 + JSON471 96.0000000 17.7717258
........**............*.......****......................*.....*......****
(((((.((((...)))....(((.(((((.[.....))))).){))((((.(..]).)))))})))))..... + JSON154 + JSON432 + JSON471 105.0000000 17.5888835
........**......**.............****.....................*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))((((.(...).)))))])))))..... + JSON169 + JSON432 + JSON471 + JSON615 112.0000000 17.5772109
........**......****..*.......****......................*.....*......****
(((((.((((...)))....(((.((((([[.....))))).){))(((.....]]..))))})))))..... + JSON154 + JSON386 + JSON432 + JSON471 121.0000000 16.5955778
........**......**.............****..............****...*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))(((.........))))])))))..... + JSON169 + JSON386 + JSON432 + JSON471 + JSON615 128.0000000 16.5828646
........**......****..*.......****...............****...*.....*......****
(((((.(.(([.........{)).(((((.(...).))))).][(}[[[[.[..)].]]]])])))))..... + JSON322 + JSON471 + JSON478 + JSON615 132.0000000 15.2549277
........**..********...........***................*...........*......****
(((((((.............(...((((((....).)))))....)(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON432 + JSON473 + JSON478 + JSON615 141.0000000 14.8831569
........************.**.......****.......****....****...............*****
((((((..(((.........))).(((((.......)))))....(((((.(...).)))))))))))..... + JSON38 2916.0000000 14.7452026
*******.*******......*****.....******............................********
((((((..(((.........))).(((((.......)))))....((((.........))))))))))..... + JSON38 + JSON386 2932.0000000 13.7508564
*******.*******......*****.....******............****............********
((((((..(((.........))).(((((.......)))))....((....(...)....))))))))..... + JSON38 + JSON473 2941.0000000 11.8254010
*******.*******......*****.....******..........****...*..........********
(((((((.............(...((((((....).)))))....)(((.........))))))))))..... + JSON169 + JSON386 + JSON432 + JSON432 + JSON473 + JSON478 + JSON615 141.0000000 14.8831569
........************.**.......****.......****....****..*.............****
(((((.(.(([.........{)).(((((.(...).))))).][(}[[[[.[..)].]]]])])))))..... + JSON322 + JSON471 + JSON478 + JSON615 132.0000000 15.2549277
........**..********...........***......................*.....*......****
(((((.(((([..)))....((..((((((....).))))).][))((((.(...).)))))])))))..... + JSON169 + JSON432 + JSON471 + JSON615 112.0000000 17.5772109
........**......****..*.......****................*...........*......****
(((((.((((...)))....(((.(((((.[.....))))).){))((((.(..]).)))))})))))..... + JSON154 + JSON432 + JSON471 105.0000000 17.5888835
........**......**.............****...............*...........*......****
(((((([((([..))).)..((..((((((....).))))).]{))((((.(...).))))]})))))..... + JSON169 + JSON432 + JSON471 96.0000000 17.7717258
........**............*.......****................*...........*......****
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 80.0000000 17.8060915
........**.....................***......................*.....*........**
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON615 32.0000000 19.2280288
................****............**.....................................**
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON615 1.5000000 19.2280288
................****............**.....................................**
(((((((((([..)))....(((.(((((.(...).))))).])))((((.(...).)))))))))))..... + JSON322 + JSON615 1.5000200 19.2269926
................****............**.....................................**
(((((((.(([.....))..(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 + JSON478 1.7737056 18.3718588
............****................**...................................****
((((((((((...)))....(([.((((((....).)))))...))((((.(...).))))))))))).]... + JSON169 + JSON615 + JSON763 1.8613531 18.3583187
................****..........****.......***...........................**
.((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).))))))))))...... + JSON322 + JSON432 + JSON615 2.0000000 18.2455939
................****............**.................................******
(((((((((({..)))....(((.((((([([..).))))).})))(((....].]..))))))))))..... + JSON322 + JSON386 + JSON615 2.0000200 18.2347086
................****............**...............****..................**
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 3.0000000 17.8060915
........**.....................***......................*.....*........**
(((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))])))))..... + JSON322 + JSON471 + JSON615 3.5000000 17.6115766
........**......****...........***......................*.....*........**
.((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))]))))...... + JSON322 + JSON432 + JSON471 + JSON615 4.0000000 16.6291417
........**......****...........***......................*.....*....******
.((((.((((...)))....(((.((((([(...).))))).){))(((......]..))))}))))...... + JSON322 + JSON386 + JSON432 + JSON471 + JSON615 4.5000000 15.6358360
........**......****...........***...............****...*.....*....******
(((((.(.(([.........{)).(((((<(...).))))).][(}[[[.....)>..]]])])))))..... + JSON322 + JSON386 + JSON471 + JSON478 + JSON615 4.7737056 14.2616220
........**..********...........***...............****...*.....*......****
.((((.((((...)))....(((.(((((.(...).)))))[){))(....(...)...]))}))))...... + JSON322 + JSON432 + JSON471 + JSON473 + JSON615 4.8613531 13.7313706
........**......****...........***.............****...*.*.....*....******
.((((.((.....[[)....(]].((((([(...).)))))..{[)(((.....]]..))))}))))...... + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 5.0000000 13.7177100
........****.**.****...........***...............****...*.....*....******
(((((.(.((..........[)).(((((.(...).)))))(({(][....[..)]..))])})))))..... + JSON322 + JSON471 + JSON473 + JSON478 + JSON615 5.1350587 12.3759713
........**..********...........***.............****.....*.....*.....*****
.((((.....(..[[)....(]]..(((([(...).))))...{[)(((.....]]..))).}))))...... + JSON322 + JSON386 + JSON432 + JSON471 + JSON615 + JSON632 5.2737056 11.9911280
......****...**.****...**......***...............****...*.....*....******
.((((.((.....[[)....(]].(((((.(...).)))))[[{.)(....(...)..]]))}))))...... + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 5.3613531 11.8157013
........****.**.****...........***.............****...*.*.....*....******
.((....(.....[[)....(]].((((([(...).))))).{{[)(((.....]]..))).}.}))...... + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 + JSON928 5.5000000 11.2444565
...****.****.**.****...........***...............****...*.....*....******
.(........(..[[)....(]].((((([(...).))))).{{[)(((.....]]..))).}..})...... + JSON322 + JSON386 + JSON432 + JSON433 + JSON471 + JSON615 + JSON632 5.7737056 10.1268257
..********...**.****...........***...............****...*.....***..******
.((....(.....[[)....(]].(((((.(...).)))))[[{[)(....(..])..]]).}..))...... + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 + JSON928 5.8613531 9.3610813
...****.****.**.****...........***.............****.....*.....**...******
.((....(.....[[)....(]].((.[.[(...)....)).{{[)(((.....]].]))).}.}))...... + JSON156 + JSON322 + JSON386 + JSON432 + JSON432 + JSON471 + JSON615 + JSON928 6.0000000 8.2749650
...****.****.**.****...........***.****..........****...*.....*....******
.(........(..[[)....(]].(((((.(...).)))))[[{.)(....(...)..]]).}...)...... + JSON322 + JSON432 + JSON433 + JSON471 + JSON473 + JSON615 + JSON632 6.1350587 8.2098083
..********...**.****...........***.............****...*.*.....***..******
.(........(..[[)....(]].((.[.[(...)....)).{{[)(((.....]].]))).}..})...... + JSON156 + JSON322 + JSON386 + JSON432 + JSON433 + JSON471 + JSON615 + JSON632 6.2737056 7.1573341
..********...**.****...........***.****..........****...*.....***..******
.((....(.....[[)....(]].((.[..(...)....)){{<[)(....(..]).]}}).>..))...... + JSON156 + JSON322 + JSON432 + JSON432 + JSON471 + JSON473 + JSON615 + JSON928 6.3613531 6.3915897
...****.****.**.****...........***.****........****.....*.....**...******
.(........(..[[)....(]].((.[..(...)....)){{<.)(....(...).]}}).>...)...... + JSON156 + JSON322 + JSON432 + JSON433 + JSON471 + JSON473 + JSON615 + JSON632 6.6350587 5.2403168
..********...**.****...........***.****........****...*.*.....***..******
.((((.((((...)))....((..(((((.({..).)))))[[<))(....(.}.)..]]))>))))...... + JSON322 + JSON432 + JSON471 + JSON473 + JSON615 4.8613531 13.7314599
........**......****..*.........**.............****...*.*.....*....******
.((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))]))))...... + JSON322 + JSON432 + JSON471 + JSON615 4.0000000 16.6291417
........**......****...........***................*...........*....******
(((((.((((...)))....(((.(((((.(...).))))).)[))((((.(...).)))))])))))..... + JSON322 + JSON471 + JSON615 3.5000000 17.6115766
........**......****...........***................*...........*........**
(((((([(((...))).)..(((.(((((.(...).))))).){))((((.(...).))))]})))))..... + JSON322 + JSON471 3.0000000 17.8060915
........**.....................***................*...........*........**
__'CRYSTAL_STRUCTURE_OF_A_TIGHT-BINDING_GLUTAMINE_TRNA_BOUND_TO_GLUTAMINE_AMINOACYL_TRNA_SYNTHETASE_'_(PDB_00376)
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGAGGUCGAGGUUCGAAUCCUCGUACCCCAGCCA
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... 0.0000000 19.2280288
.........................................................................
(((((((((([..)))....(((.(((((.({..).))))).])))((((.(.}.).)))))))))))..... + JSON322 0.0000000 19.2280288
................................**.....................................**